j4gq4c2yt2 j4gq4c2yt2

04-06-2023
Mathematics

contestada

Find the variance for the given data. Round your answer to one more decimal place than the original data. -12 6 -3 6

Respuesta :

agitheva24 agitheva24

04-06-2023

Answer:

5 is the answer due to the ecomiisnsko

Answer Link

Otras preguntas

Rewrite the following rectangular equation in polar form assuming a is a real constant.x2 + y2 = 11a=

.The balance on Mr. Finch's credit card is -$210. It is 3 times the balance on Mr. Nguyen's credit card. Find the quotient -210 ÷ 3 and explain what it means in

Number one please How many planes can be drawn through any three non collinear points?

You are creating a precipitate of silver chloride, starting with 1.00 mol of silver nitrate (AgNO3) and 0.75 mol of potassium chloride (KCl):AgNO3 (aq) + KCl (a

find the Area and Perimeter of the shaded figure Area = x squre unitsPerimeter = x units

Find the circumference of the circle. Give the exact circumference and then an approximation. Use i 3.14. diamater of 17cm

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.

Ashley took 3 minutes to run a distance of 540 meters from point X to point YGrace took 2 minutes to run a distance of 480 meters from point Z to point YA)Find

The equation that models Earth's elliptical orbit around the sun is (x+2.5)^2/22,350.25+y^2/22,344=1 in millions of kilometers. If the sun is located at one foc

Russell is eating at a restaurant. His total bill comes to $44.85. If Russell decides to leave a tip that is approximately 20% of the total bill, how much shoul