StormJ4964 StormJ4964
  • 02-06-2017
  • Mathematics
contestada

Consider the expression 8 - 4 + 2. One student says the answer is 2 and another says it is 6. Which student is correct? Explain what went wrong with the student who made a mistake.

Respuesta :

PatrickSC
PatrickSC PatrickSC
  • 03-06-2017
The correct answer is 6. The reason 2 is wrong is you have to be in the correct line of order always remember Please Excuse My Dear Aunt Sally! 
Answer Link

Otras preguntas

how do i find the angles on a kite?
2ln(5x)=8 solve for x
I want to work with LDAP. what is LDAP?
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October
which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Failure to incorporate _______ can easily lead to _______. Would the answer be: citations, plagiarism?
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before
p(x) x^3+x^2-x-1 Find all zeros of p (x)