seleneknoth
seleneknoth seleneknoth
  • 02-09-2021
  • Chemistry
contestada

Help please this is due tomorrow and I have a lot to do

Help please this is due tomorrow and I have a lot to do class=

Respuesta :

mgwinn
mgwinn mgwinn
  • 02-09-2021

Answer:

pressure

Explanation:

the metore put pressure on the earth, so the earth shifted

Answer Link

Otras preguntas

Solve for x. Assume that lines which appear tangent are tangent.
The small organs used by spiders to produce silk are called _____________. silk nozzles spinnerets pedipalps mouthparts
Which of the following can be a cause of social change?
Which factor controls the water cycle? A. Energy from the sun B. Changing ocean currents C. Volcanic eruptions D. Burning of fossil fuels
PLEASE HELP ASAP A diagonal length of a rhombus is multiplied by 2/3. Which of the following describes the effect of this change on the area?
14. Find the coordinates of the circumcenter for ∆DEF with coordinates D(1,3) E (8,3) and F(1,-5). Show your work.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What is the lowest level of measurement that a median can be computed?
Which of the following shows the graph of y=In(-2x)
Researchers are exploring whether treatment with ________ might improve social behavior in those with asd.