mattghebremicael76 mattghebremicael76

05-02-2021
Mathematics

contestada

Write the first four terms generated be the sequence n(n-1) where n>=1.

Respuesta :

el6757575693 el6757575693

05-02-2021

Answer:

(n=1 so n-1 its) 1-1=0

Step-by-step explanation:

Answer Link

Otras preguntas

When a molecule can best be represented as a series of resonance forms, each of these forms always contributes to the same degree in the hybrid?

Pete slid a domino off a bridge and it took 2.3 seconds to hit the Gully below how many feet did the domino fall

What was the extent of islamic expansion one century after muhammad's death?

El clima de la costa Guatemalteca es tropical, es decir es ______________________.

Quadrilateral abcd is inscribed in this circle. what is the measure of angle a?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

When reading for subject content, prereading activities are not important. Please select the best answer from the choices provided True or False

What are at least three differences between apes and humans in the cranium and teeth?

Which american colony was established in the 1660s as a haven for quakers?

the length of a rectangle is twice its width. If the area of the rectangle is 50 ft ^2, find its perimeter.PLEASE HELP!!!!!!!!REALLY IMPORTANT HAVE TO FINISH MY