julio2129 julio2129

02-11-2018
Arts

contestada

Can you learn art or is it innate?

Respuesta :

Аноним Аноним

02-11-2018

You can learn the basics and then try to make some art with what you know.

Hope this Helps!

Answer Link

beth7361 beth7361

02-11-2018

I do believe that some people have more of a natural inclination towards art but I still see it as something that can be learned. Art is subjective but it is also still a technical skill that can be learned.

Answer Link

Otras preguntas

Find the missing length indicated

A 12-foot ladder leans against the side of a house with its base 3 feet from the house. use the pythagorean theorem to approximate how high the ladder reaches u

[tex]Let \: \: f(x)= [ \dfrac{ \sin(x) }{x} ] + [ \dfrac{ 2\sin(2x) }{x} ] + \: ... \: [ \dfrac{ 10\sin(10x) }{x} ] \\ \\ Where \: [y] \: is \: the \: largest \

The brackets are indicating a(n) _____ bond. the brackets are indicating a(n) _____ bond. hydrogen polar covalent single (nonpolar) covalent hydrophobic ionic

What is [tex] \frac{1}{x+2} +\frac{6}{x-5} [/tex] equal to?Please show most of your work!!!Thank you!!

PLEASE HELP ASAP find the quotient of -12x^3 + 21x^2 - 6x/ -3x.-4x^2 - 7x + 184x^2 + 7x + 18-12x^3 + 21x^2 + 24x^2 - 7x + 2

CAN SOMEONE HELP ME PLEASE ?

what are the zeros of the function? f(x)=+-6x

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

The name for people who stay in one place like civilization of china and kroea